The discovery of new SNPs can result in assignment of new names to haplogroup categories. G2a2b2a is also found in India. and JavaScript. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). Mol Biol Evol 2006; 23: 22682270. Internet Explorer). Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Network of 248 samples P303 derived from Supplementary Table S3.
8 Oldest Haplogroups and the Regions they Originated From The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Cinnioglu C, King R, Kivisild T et al. Russ J Genet 2004; 40: 326331. Am J Hum Genet 2004; 74: 5061. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. The origin of haplogroup G is controversial. Distribution. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. Members of this group have been found in Europe and the Middle East.[3]. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. P15 was identified at the University of Arizona and became widely known by 2002. Nei M : Molecular Evolutionary Genetics. The origin of haplogroup G is controversial. Am J Hum Genet 2002; 70: 265268. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. In addition, there are multiple other SNPs thought to have the same coverage as M201. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Semino O, Passarino G, Oefner PJ et al. Hum Hered 2006; 61: 132143. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Origin and Migrations of Haplogroup G-M201 The first man to carry haplogroup G-M201 likely lived in southwestern Asia or the Caucasus between 46,000 and 54,000 years ago. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Origin. Google Scholar. The Sea Peoples, from cuneiform tablets to carbon dating. Lacan M, Keyser C, Ricaut FX et al. L2b1a. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. To obtain Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. Haplogroup P (P295) is also klnown as K2b2. Human Y chromosome DNA grouping common in western Eurasia, This article is about the human Y-DNA haplogroup. In the meantime, to ensure continued support, we are displaying the site without styles
N-mtDNA - Background | FamilyTreeDNA Eur J Hum Genet 2009; 17: 820830.
Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E Haplogroup G-M201 | Familypedia | Fandom Achilli A, Olivieri A, Pala M et al. volume20,pages 12751282 (2012)Cite this article. Balanovsky O, Rootsi S, Pshenichnov A et al. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. The P303 SNP defines the most frequent and widespread G sub-haplogroup. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Ann Hum Genet 2005; 69: 443454. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. P257 was first reported in 2008. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. G-P16 has a high frequency in South and NW Caucasus, with the highest frequency among North Ossetians63.6%. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Am J Hum Genet 2003; 72: 313332. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). On this Wikipedia the language links are at the top of the page across from the article title. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. It is provided at the request of readers. In other words, these mutations are so unique that they could only come from other cells with the same mutations. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. [43] L240 was identified in 2009. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. PAU thanks Professor Carlos D Bustamante. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . Specifically, we intersected these criteria by applying the following filters. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. Semino et al. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in
Frontiers | The Geographic Origins of Ethnic Groups in the Indian We attempted to localize the potential geographic origin of . Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. Am J Hum Genet 2012; 90: 573. [2][37], Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[2]. Martinez L, Underhill PA, Zhivotovsky LA et al. Int J Legal Med 1997; 110: 134149. Article Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Kivisild T, Rootsi S, Metspalu M et al. King RJ, DiCristofaro J, Kouvatsi A et al. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. Although no basal G-M201* chromosomes were detected in our data set, the homeland of this haplogroup has been estimated to be somewhere nearby eastern Anatolia, Armenia or western Iran, the only areas characterized by the co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Chromosome Y microsatellites: population genetic and evolutionary aspects. BMC Evol Biol 2011; 11: 69.
G-L13/S13 (Y-DNA) - geni family tree "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. The SNP L177 (a.k.a. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. . The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. Am J Hum Genet 2008; 82: 236250. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations.
The genetic variation in the R1a clade among the Ashkenazi - Nature Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. See: Poznik. Forensic Sci Int-Gen 2007; 1: 287290.
Where did the haplogroup G-M201 originate? - Quora Nasidze I, Quinque D, Dupanloup I et al. (Previously the name Haplogroup S was assigned to K2b1a4.
Haplogroup Definition & Meaning | Dictionary.com (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Ann Hum Genet 2008; 72: 205214. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. Y-chromosomal diversity in Lebanon is structured by recent historical events. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. P287 was identified at the University of Arizona and became widely known in late 2007. [5] Cinnioglu et al. Am J Hum Genet 2008; 82: 873882. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. The G-M286 subclade (M286+) is small compared with G-L91. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree.
Ponte Vedra High School Clubs,
Fatal Car Accident Massachusetts 2022,
Traditional Romani Jewelry,
Articles H